Regulators and Effectors of Small GTPases, Part E: GTPases Involved in Vesicular Traffic

Regulators and Effectors of Small GTPases, Part E: GTPases Involved in Vesicular Traffic

4.11 - 1251 ratings - Source

Small GTPases play a key role in many aspects of contemporary cell biology: control of cell growth and differentiation; regulation of cell adhesion and cell movement; the organization of the actin cytoskeleton; and the regulation of intracellular vesicular transport. This volume and its companions (Volumes 255, 256, 257, and the forthcoming 325) cover all biochemical and biological assays currently in use for analyzing the role of small GTPases in these aspects of cell biology at the molecular level.Follow instead the instructions in the Gibco Bacto-Bac user manual. ... primers oligo(A)5 GTTTTCCCAGTCACGACGTTGTAAAACGAC3 oligo(B) 5 AGCGGATAACAATTTCACACAGGAAACAGC 3 and the following PCR conditions (94 for 5 min, anbsp;...


Title:Regulators and Effectors of Small GTPases, Part E: GTPases Involved in Vesicular Traffic
Author:
Publisher:Academic Press - 2001-02-08
ISBN-13:

Continue

You Must CONTINUE and create a free account to access unlimited downloads & streaming